ygpfbz9zj9 ygpfbz9zj9
  • 15-10-2022
  • Biology
contestada

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

Respuesta :

Otras preguntas

A department store is having a 55% off sale on all sport coats. If you have a coupon for an additional 10% off of any item, how much will a $230.00 sport coat c
A rectangular room is four times as long as it is wide, and its perimeter is 70 meters. Find the width of the room.
Evaluate the expression (11/7)(5/3)(3/1)
Jack, Jill, and Ron share a 2-bedroom apartment. Rent is represented by R. The water bill is $20 per person. The electric bill is $250 a month. Jill will be pic
How to solve this problem .         0.3 [1.57 – (0.6)²]
what is: A student is raising money for cancer research. A local business agrees to donate an additional 25% of what the student raises, while a local politicia
Use the following words to write your own poem for your school'S POENTRY COMPETITION--bed-red-head-said-fed--see-bee-free-tea-agree--ship-lip-slip-equip-skip--e
A rectangular room is four times as long as it is wide, and its perimeter is 70 meters. Find the width of the room.
What responsibility did the alliance systems play in the outbreak of the war
one-sixth of a number is 66