aidenlumpkins219 aidenlumpkins219

13-11-2022
Biology

contestada

Using the following genomic sequence:

1) Underline each intron

2) Circle each exon

UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG

AUAAUGUUUUUACCCACCAACGACGCCAUGUGACGUCGAAUGACUACCAAUGCU

GCUGGACUAACAUAAUCGUAUGGAAGGGUGUCAAUGUUCUCCUAUGUAAUGUAA

CAUAAU

Respuesta :

Otras preguntas

During the first year, a bakery sold 37,580 bags of cookies. During the second year, the bakery sold 5,000 more bags than were sold the first year. What is the

What is landmass that surrounded by water on all sides

calculate heat produced when 80000 coulombs of charge is transferred in 1/2 hour through a potential difference of 40 volts

The Commonwealth of Nations primarily consists of former..

Solve the system by substitution method X=-4y+4 3x-7y=-7

A mixture of alcohol and water is homogeneous while that of oil and water is heterogeneous.explain

a stray dog ate 12 pf your muffins.that was 3/10 pf all of them.with how many did you start

c+ax=dxthis one has all variables and no numbers

Find the slope and the y intercept of the line Y=1/2x-8

The fish, dog, and bird are alike in many ways. One way is that they all have — A legs B hair C lungs D backbones