wilkybaptiste08
wilkybaptiste08 wilkybaptiste08
  • 15-11-2022
  • Mathematics
contestada

The graph of the function f (x) is shown.
44
..
If g(x)=f(x-3), then select all the statements that are true.
o The value of g (1) is 3
O The value of g (-1) is 1.
O The value of g (-1) is 8.
The y-intercept of g (z) is at the point (0, 1).
The y-intercept of g (z) is at the point (0, 4)

Respuesta :

Otras preguntas

Please help me and hurry thx
Explain one guideline that will help a speaker use or create an effective presentational aid. Provide examples.
please help me, I am very confused i will give brainliest
What might happen to the owl population if there were less rabbits, mice, and snakes in a given year
ACTIVATE Think about an adventure story that you have read. Answer the questions. 1 Who is the author of the story? 2 Is it written in the first person or the t
Concept in statistics
[tex](5 \sqrt{3} ) {}^{2} + 5 { }^{2} = x {}^{2} [/tex]​
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein
Alyssa says that n = 6 is the solution of the equation 12n = 84. How can you check whether she is correct?
HELP ITS DUE TODAY!! list things that the government can do to create more employment ​