sharidler sharidler

15-12-2022
Biology

contestada

original DNA: TACTTTAATCCCAAATTTACT

DNA: TACTTTAATCCCAAGTTTACT
mRNA: ?
amino acid: ?
what type of mutation is this: ?

Respuesta :

Otras preguntas

What is the range of rooms in Henry's histogram?The houses surveyed had between 1 and 10 rooms.The histogram shows a range of 5 to 6 rooms.The houses surveyed h

Line r cuts a pair of parallel lines. One of the eight angles created measures 90°. Which statements about the angles are true? A. All the angles are congruent

during the 1920s the field of psychology saw women as

why is it important to prevent the mixture of the product in the electrolysis of brine

If i^2 = −1 and a = (i + 7), which is the result of squaring a?

Which of the following ratios would form a proportion with 4/5?

The temperature is 50°F The temperature will decrease by 4°F each hour. Let h be the number of hours, When will the temperature be below 32°F? Write an inequali

A jeweler designing a pin has decided to use five stones chosen from diamonds, rubies, and emeralds. In how many ways can the stones be selected?

M1Q11.) What percent of women in their 40s taking a screening mammography receive a false positive?

P^-4q^3r^-7 over p^-2q^3p^-2 simplify