patrickfutrell9820 patrickfutrell9820

12-01-2024
Mathematics

contestada

What is the magnitude of this correlation? Make an educated guess based on the direction of the slope, and the distribution of the data points
A. 0.1
B. 0.5
C. 0.7
D. 0.9

Respuesta :

Otras preguntas

what is a credit union? a-a bank that takes deposits but does not make loans b- a bank that specializes in retirement savings accounts c- a modified type of sa

According to Brueghel/ when Icarus fell/ it was Spring What literary technique is being used in the above passage? A). symbolism B). irony C). allusion D). met

Which sentence best describes an objective news source? A. No newsroom staff is present to filter information. B. Some content is purposely left out by ne

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

If a particular utility burned 2.90 million tons of coal that was 2.00% sulfur by weight, how many tons of sulfur dioxide was emitted?

When a certain type of thumbtack is flipped, the probability of its landing tip up (U) is 0.66 and the probability of its landing tip down (D) is 0.34. Suppo

The set of life spans of an appliance is normally distributed with a mean mc013-1.jpg = 48 months and a standard deviation mc013-2.jpg = 8 months. What is the l

How many syllables are in the word interactive?

think sista might could be preganart? help?!?!?

A(n) ____ will, for a commission or fee, arrange the sale of a company's products to foreign intermediaries.