pinktigerpop70701 pinktigerpop70701
  • 13-03-2024
  • Biology
contestada

Replicate the following gene strand, and then transcribe the template strand:
GTTAATGGCCATGATGGCTTTGTGATTAAGC .Translate the mRNA from above using single letter abbreviations for the amino acids
(if you do it correctly it should spell something).

Respuesta :

Otras preguntas

A 25.0 kg child on a swing kicks upward on the downswing thus changing the distance from the pivot point to her centre of gravity from 2.40 m to 2.28 m. What i
The position of a place north or south of the equator is measured in ?
Explain the role of energy in changes of state.
what kind of device can you use to to separate visible light into its different colors
A lizard accelerates from 2 m/s to 10m/s in 4 seconds. What is the lizard’s acceleration?
What is the value of this please help
How do you write 7,330,968 in expanded form
Tom has twice as many marbles as Luke. Together they have 39 marbles. How many marbles does Tom have?
What are the next three numbers in this pattern? 6,000 6,003 6,009 6,018 6,030 6,045 ... .. ...
List three examples of a primary economic activity?