Breannaskinner8898 Breannaskinner8898

14-03-2024
Mathematics

contestada

Find the derivative of 2x³+x²-20x+7.
A) 6x²+2x−20
B) 6x²++2x−7
C) 3x²+2x−20
D) 6x³+2x² −20x
E) 6x²+x−20

Respuesta :

Otras preguntas

a woman with type o blood marries a man with type ab blood is it possible for their children to have O blood

please help me answer this question! (25pts) :(

What conclusions can you draw about the relationship between chemical structure and dye color?

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds

Which sentences correctly use the word expel? Choose all answers that are correct. A. We learned a move to help a choking person expel a foreign object. B. When

Bella is making button barrettes. She allows each of her friends to reach into her bag of buttons and randomly select a color. Then she replaces it with the sam

Stress at moderate levels that produces positive results is called

Matilda takes benzodiazepines as she suffers from anxiety disorder. As a side effect of taking benzodiazepines, Matilda is most likely to face a risk of:

The following are examples of positive sanctions except a. praising children for good behavior. c. a no parking reminder. b. getting a good grade from a teac

Carbohydrate groups on the surfaces of erythrocytes determine blood type and are known as