aryanamunoz04 aryanamunoz04

14-04-2020
Biology

contestada

A restriction enzyme is coded for: AT!GC

How long would the Base Pair fragments be for this DNA sequence?

AGTCGAGTATATGCATGGCCGCGAT

1)25 and 0
2)25 and 25
3)14 and 11
4)12 and 13

Respuesta :

exspressgirl27oz2xjv exspressgirl27oz2xjv

21-04-2020

Answer: The answer is 4) 12 and 13

Explanation: you count the A and T together, which is 12. Then you count the G and C together, which is 13. I just took a test with this question and got it correct

Answer Link

Otras preguntas

Music influences and impacts the world that we live in. How is music used in different parts of the world and in different areas of life (movies, religion, etc.

what country did john white represent? what is the date that john white did somethimh important? & what did he do that he is remberd for?

(8i)(4i)(-9i) simplify

Mainland China is controlled by the Communists whereas Taiwan is controlled by

Mainland China is controlled by the Communists whereas Taiwan is controlled by

how does rock cycle impact the lithosphere?? plzzz HELP.!!!

What is the difference between a pirate and a sailor

Is it possible for a number to be a rational number that is not an integer but is a whole number? PLEASE EXPLAIN

fats are made of an alcohol called ?

What's the components of essay organization?