alexandrabdastjerdi alexandrabdastjerdi

15-04-2020
Mathematics

contestada

How many solutions does 23 + 4x = 4x - 9 have?

Respuesta :

russianh4cker russianh4cker

15-04-2020

Answer: no solution
There is No solution to this.

Answer Link

Otras preguntas

bob rides his bicycle on a bike path that is 75 kilometers long to get to his house that is due east of the bike path. If it takes bob 15 hours then what is his

The equation - 5x² + 72x + 378 models the number of students enrolled in a school where x is the number of years since the school first opened in 1990. Which st

What are the roles of mucus? Check all that apply. A)to trap pathogens B)to start fevers C)to prevent pathogens from moving into deep tissues D)to stimulate B-c

I need to make my own creation myth and I was wondering what you guys think I should add to what I have: There once was a young god, new to the universe and imm

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the

Bill is in a class of 15 boys and 35 girls.40% of the students in the class take the bus to the school.How many students do not take the bus to school?

How does Cry, the Beloved Country, by Alan Paton, reflect the cultural experiences of South Africans in the late 1940s? Through its depiction of Absalom’s and G

Literary nonfiction, such as autobiography, is written by a person about his or her own true life experiences in omniscient third-person point of view.

What is it called when money paid to a ruler or government in exchange for protection,goods,services ALSO THIS IS FOR THE AZTEC, INCA AND MAYA

A cylindrical water tank has a diameter of 6 meters and a height of 9 meters. What is the maximum volume of water the tank can hold? (to nearest whole number) A