kikimoose2000 kikimoose2000

12-08-2016
Mathematics

contestada

identify two integers with given product and sum
A product 36 and sum -13
B product -9 and sum 0

Respuesta :

MartynBH MartynBH

12-08-2016

Your answer is negative 9 and negative 4.

Answer Link

Otras preguntas

I need help with this If you help me we can talk ;)

Which of the following is NOT a safety precaution used in strength training? A)Locking the door before you begin your strength training program.B)Approval from

The New Jersey plan gave Congress the power to set taxes and regulate trade. True or false

Which is a product of the Krebs cycle? A. Pyruvate B. NAD c. Acetyl COA D. FADH2

There are seven numbers in this list: 0.123, -0.123, 0.112233, 0.13, -0.0123, 0.1223, 0.125 Ashley rewrites the seven numbers in order from least to greatest

16- X at x= 5 Hurry

what was the children’s march

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 5

How do you solve point slope form with only a slope and a y intercept

What is the circumference of a circle with a radious of 7?