sophiafriend34 sophiafriend34
  • 15-05-2020
  • Biology
contestada


Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Respuesta :

queenb74
queenb74 queenb74
  • 15-05-2020
The answer is DNA I know because I know
Answer Link
savitar0291 savitar0291
  • 15-05-2020

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

Answer Link

Otras preguntas

"A Pair of Silk Stockings" best represents literary A. realism. B. symbolism. C. escapism. D. allegory. B ?
Which event is the most common at oceanic-oceanic convergent boundaries? A. rift valleys B. volcanic mountain ranges C. island arcs D. earthquakes
what do all chemical breakdown processes in cells directly involve
Which statement best describes perigee? A. The Sun's orbit that is closest to the Moon B. The closet point in the Moon's orbit to Earth C. The farthest point
If a thermometer indicates 40 degrees Celsius, what is the temperature in degrees Fahrenheit? A. 72°F B. 104°F C. 22°F D. 54°F
what times what equals 59
whats 3 equivalent ratios for 5/45
a rate in which the second quantity is one unit
Suppose the diameter of a circle is 9. What is its circumference?
explain why it is necessary to rename 4 1/4 if you subtract 3/4 from it.