yourlocalthotbeatrix yourlocalthotbeatrix

11-10-2020
Arts

contestada

whats the best thing to smash when you’re angry?

Respuesta :

backto2021 backto2021

11-10-2020

Answer:

Slime is probably the best or maybe like a pillow.

Answer Link

Otras preguntas

Which statement is NOT true about religion in South and North Korea? a Over 40% of Koreans follow no religion. b Christianity is South Korea's largest religion.

Can someone please help me with this? thanks

Will mark Brainliest please answer

Help with history! Which title best completes the chart?

Who do you think "won" the Space Race? Explain why

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

6th grade math! Help me please :)

What are bees family

The frequency table shows the results of drawing 20 cards from a bag of 100. There are an equal number of cards of each color in the bag. Which color has the sa

How did the Warsaw Pact and NATO divide Europe?A)The Warsaw Pact signaled the Eastern European countries that the Soviets would help rise after the war and NATO