sergio9000 sergio9000

12-10-2020
Biology

contestada

Translate the following DNA sequence:
ATGCCATGGCATTGA

Respuesta :

chefchinoba2020 chefchinoba2020

12-10-2020

The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Answer Link

Otras preguntas

L’impressionnisme n’a pas tout de suite été bien reçu par les critique d’art true or false

What is an EDC and what is one example of it?

In the diagram, ABC is a straight line such that AB = 6.8 cm,BC=17.6cm,BD=8.8cmand ADB = 21.3°. Calculate(a) the angle BAD,* (b) the length of CD,*(c) the lengt

What clues tell Scout that the man in the corner is NOT a "countryman"? Explain, with examples and page numbers from the text.

HELPPPPP WILL GIVE BRAINLIEST!!! A dwarf planet is a? 1.small, rocky object that orbits the Sun and is usually found in a belt between the orbits of Mars and Ju

A competitive cheer team allows only the top 4% of athletes who try out to be part of the team. If the team tryout scorecard has a mean of 200 and a standard de

What is Washington saying in this quotation?

What do you think is Columbus attitude toward the Taino people

Order the numbers from least to greatest. -7/5, -1 5/11, -1.45, -1 91/200

What’s the esophagus for?