i1nizam1i i1nizam1i

13-10-2020
Biology

contestada

DNA: TAC-GGC-ATA-GCA-TTT-CAC-TAA

What is the corresponding RNA sequence for the DNA strand above?

DNA TACGGCATAGCATTTCACTAA What is the corresponding RNA sequence for the DNA strand above class=

Respuesta :

13-10-2020

Answer:

Changing G to C

C to G

A to U

and T to A, the answer will be C

Answer Link

Otras preguntas

Need help with solving please

What is the vision and mission statement of the organization

Biological psychopathology is the study of the genetic influence on ______ processes, A. growth B. cognitive C. social

Speech about Money can’t buy love or happiness

Most of the body's heat results from a. physical exertion. b. the surrounding environment, such as sunlight. c. chemical reactions occurring in cells. d. the ac

Write an equation of the line that passes through the point (-6, -9) with slope-5. A. y + 9 = 5(20+6) B.y +6 = 5(x +9) c.y+9= -5(x + 6) D.y +6 = -5(x +9)

Which of the following is key to patient compliance when providing patient education? A. Nonchalance B. Motivation C. Criticism D. Information I picked D. I

5. Resolve into factors. a) 2x + 5x + 3please do this

Complete with the subjunctive present Como quiera que (ir) a la escuela, debes llegar a tiempo. Quienquiera que (ir) al supermercado, debe comprar fruta. Cualq

Define the concept risky behavior and explain why it is important for youths to investigate and be knowledgeable about it.