neriahcurry neriahcurry

14-10-2020
Business

contestada

Community colleges and vocational schools offer programs in maintenance and repair.
A
True
B.
False

Respuesta :

jrsnow42 jrsnow42

14-10-2020

I think I answer would be true

Answer Link

cperez08 cperez08

14-10-2020

The answer will be A True

Answer Link

Otras preguntas

You are a traffic accident investigator. You have arrived at the scene of an accident. Two cars of equal mass (1,000 kg each) were involved in a rear-end accide

You take out a $10,000 loan to purchase a used car. You have the choice to pay back the loan at 5% interest for 60 months (5 years), or 3% interest for 36 month

∠a and ∠b are complementary angles. ∠a measures 67੦. What is the measure of ∠b?

As part of his Venetians series, Dale Chihuly adds Art Deco-inspired floral _______ onto the surface of his Misty Cerulean Venetian vase. (pages 4-5) * a. symbo

Mood and narrative techniques in lather and nothing else quiz

A glass ball is packed in the box shown. Which expression represents the volume of foam padding needed to fill the space in the box around the sphere in terms o

Six facts about the Korean War

QUESTION 1Minorities can be more influential if they use new and unexpected information.TrueFalse

Which represents where f(x) = g(x)? C f(2) = g(2) and f(0) = g(0) C f(2) = g(0) and f(0) = g(4) c f(2) = g(0) and f(4) = g(2) C f(2) = g(4) and f(1) = g(1)

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG