haydenrosejackson1 haydenrosejackson1

15-10-2020
Biology

contestada

What is the complementary strand for this segment of DNA? I'll give u 15 point pls answer

What is the complementary strand for this segment of DNA Ill give u 15 point pls answer class=

Respuesta :

zayveionbrown zayveionbrown

15-10-2020

I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC

Answer Link

Otras preguntas

Write a program to output the following quote by Edsger W. Dijkstra: "Computer Science is no more about computers than astronomy is about telescopes" - Edsger W

What is etiquette? describe it

What punctuation is used to show the title of a short story?

is centrioles a plant or animal cell?

Parallel to the line y=-3x + 5 passes through (-4,5)

A summer movie club charges a $30 membership fee and then $5 per movie. Which equation can be used to find y, the total cost of the movie club, if x represents

How would you express "of Rome" in Latin?

19. The planealong the runwaybefore taking off.A.taxiedB. spedC. rushedD. revvedE. ran

Please Help! Several of the nonmetals are gases at room temperature.

Which shows the following expression after the negative exponents have been eliminated? StartFraction a cubed b Superscript negative 2 Baseline Over a b Supersc