sabinapiccone sabinapiccone

15-10-2020
Mathematics

contestada

12
Mackenzie wants to buy a backpack that cost $60. If the tax rate is 7.5%, how much tax will she
pay?

Respuesta :

nathanielkoch929 nathanielkoch929

15-10-2020

Answer:

4.5

Step-by-step explanation:

7.5% is equal to 0.075 so if you multiply 60 by the decimal of 7.5% you have 4.5

Answer Link

Otras preguntas

Sister act baked muffins she added 1/2 cup of sugar to the muffin batter and then divided the batter equally into 12 sections of the muffin pan what fraction of

Please Help!! Which expression is equivalent to 5(x + 10)? A.5x + 10 B.5x + 10x C.5x + 50 D.5 + x + 10

PLEASE HELP TESOY!!!!

How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10

Find the hypotenuse length. A. 108 in. B. 110 in. C. 117 in. D. 14 in

NEED HELP ASAPRead the sentence.After his car accident, Malcolm received physical therapy, including traction on his neck.Based on the Latin root that traction

Read the newspaper headline from the June 29, 1914 issue of the New York Times. Based on the headline, which country could stop a larger war? Austria Serbia Rus

What is the most important reason for citing a source when quoting it directly? A. to give credit to the source B. to make your work seem complete C. to add

tank contains 500 kg of a liquid whose specific gravity is 2. Determine the volume of theliquid in the tank.

3/7 + (-7/8) I need this pls