ricorico01 ricorico01

11-11-2020
Biology

contestada

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Respuesta :

stefftagalilong stefftagalilong

19-11-2020

Answer:

what I don't understand what is the Ctcagt

Answer Link

Otras preguntas

What signifies that a lymphocyte has become immunocompetent?

What’s the exact volume of the cylinder?

An airplane of mass 1.60 ✕ 104 kg is moving at 66.0 m/s. The pilot then increases the engine's thrust to 7.70 ✕ 104 N. The resistive force exerted by air on the

Please help me, I don't understand. I'll give brainlyest

Which statement about enzymes is true

I need help with this Prompt! For Poitlical science 100

Mrs.greens test was normally distributed with mean of 6 and a standard deviation of 1.5

7/12 of a new dress has been sewn Chelsea did 3/7 of the sewing how much of the dress did Chelsea sew

Use the library, encyclopedia, and Internet to research and then write a 750 word report on one of the following topics: Nineteenth century isolationism The Spa

what is the x-intercept of the graphed line?