marcventura845 marcventura845
  • 14-11-2020
  • Biology
contestada

How do plants “catch” sunlight?

Respuesta :

effielambrix
effielambrix effielambrix
  • 14-11-2020

Answer: The leafs capture the suns energy.

Answer Link
TheCrazyLady
TheCrazyLady TheCrazyLady
  • 14-11-2020

Answer:

Sunlight is captured by chlorophyll.

Answer Link

Otras preguntas

how fast is the water level rising in a rectangular fish tank whose base is 20 ft^2 if the tank is being filled at a rate of 0.5ft^3/min
Why is it so difficult for winston to meet the girl?
Identify the slope and y-intercept of the equation Y=-2/3x+490
Subtract. (x2+3x−7)−(3x2−5x+3) Express the answer in standard form.
Which type of rhetorical device is used in the lines, "While some have prospered beyond imagination in this global economy, middle-class Americans—as well as th
An average, healthy adult heart pumps about ________ gallons of blood every ________ seconds.
Isaac deposits $1,500 in a savings account that earns 5% per year. How much interest will the money have earned at the end of 4 years? $60 $300 $450 $600
1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
Of a big concern to medieval theologians was if children - received religious education -died before baptism -were well fed -worked at a young age
NEED help on this one too