713sergio 713sergio
  • 15-12-2020
  • Biology
contestada

If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?

Respuesta :

peppapig200
peppapig200 peppapig200
  • 15-12-2020
UACCGCUCCGCCGCUCGACAAUACC
Answer Link

Otras preguntas

Large ____________ allow blocks of crust to be displaced downward, forming a rift. Basaltic lava erupts within the rift forming ____________ on the seafloor. Ot
I WILL GIVE BRAINLIST BUT I NEED HELP !!!!! Which of the following phrases provides a context clue for the definition of the word futile
Finch species living on the Galapagos Islands exhibit a variety of beak types that favor different foods. Finches that eat seeds and plant parts have beaks of
What is the product of 3 x 4/5??
How much power should the government have to fight terrorism in the post-9/11 era and how can we, as a nation, balance security with freedom?
How could the United States' economy truly characterized?
pls help me with ths answerr ​
if de = 6x , EF =4x, and df =10 what is DE
A. Pure Element B. Pure Compound C. Mixture of Elements D. Mixture of Compounds E. Mixture of Elements and Compounds
what is an authers purpose in having a character not fit in or be at odds with a stories setting? a. to provide exposition b.to build tension c.to establish rel