cheyyy5 cheyyy5

14-01-2021
Biology

contestada

1-5 For the following DNA sequences, replicate the DNA
1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Respuesta :

angelomontoya angelomontoya

14-01-2021

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

Answer Link

Otras preguntas

Find 4 - (-11). The difference is ?

describe how wind waves are generated

Riya's father has 6 houses in Kathmandu.(how many) in wh question

(HELP ASAP) Do these pairs of values (x and y) represent two quantities that are proportional?

When a number is decreased by 10% of itself, the result is 54. What is the number? a) Write an equation to modèl the problem. Use x to represent the number. Ans

June is 3 years older than twice her sisters age the sum of their ages is 30 years old how old are June and her sister?

8) Find the slope of RS: R(-7, -3) and S(0, -3)

What were the three reasons for the establishment of the colony of Georgia documented in the Charter of 1732?

CAN SOMEONE please help me with this question please i have 5 minutes left AND I WILL GIVE BRAINLIEST here is the question :Use the drop-down menus to complete

George helped his dad plant trees. They plant 18 to a row and 3 rows an hour. At that rate, how many would they plant in an 8 hour day?