reagenrenee08 reagenrenee08

12-02-2021
Mathematics

contestada

4x2 + 14 - 9x
X = 52

4x2 14 9x X 52 class=

Respuesta :

4806802837 4806802837

12-02-2021

Answer:

69

Step-by-step explanation:

just plug in 5 for all the x in the equation and mulitply

Answer Link

kate636 kate636

12-02-2021

Answer:

jejeiriiririrurur7urur

Answer Link

Otras preguntas

who was the 30th President in the United States?

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se

Until the second century B.C.E., roman classes were defined according to

Write the standard equation of a circle with center (2, −5) and radius 16.

when a patient is unconscious without a pulse cpr should be performed?

Which of the following types of information is suited for display on a double line graph? a. annual changes in Melody's height and weight from 5 to 10 years old

Catherine's employer matches 25% of her 401(k) contributions — up to $2000. Catherine's salary is $50,000, and last year she contributed $10,000 to her 401(k) p

Which of these sentence segments does not contain a capitalization error? maurice sendak won the caldecott award for his outstanding illustrations.

What trade agreement or union does not include the United States

URGENT PLEASE HELP If a rectangle has an area of x^2+11x+28x and length of x+7. What is the width?