zahiddoda1971 zahiddoda1971
  • 11-03-2021
  • Physics
contestada

a helium balloon containing 12m³ of gas at a pressure of 120kPa is released into the air. Assuming that the temperature is constant, calculate the volume of the balloon would have when the pressure inside the balloon has fallen to 40kPa, answer in m³

Respuesta :

DFlo2721 DFlo2721
  • 11-03-2021

Answer: 36m3

Explanation:

Answer Link
ebkem17Ebkemm ebkem17Ebkemm
  • 12-03-2021

Answer:

Explanation:

Eaton very cab

Answer Link

Otras preguntas

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG
If y = 2x+ 3, find the value of y when x = -3 Bit of help please?
What’s the correct answer for this question?
what does Quinton mean
Explain why matter takes space
need ASAP!! will give brainliest!!! if u dont know the answer pls dont answer I NEED ANSWERS TO EITHER QUESTION NO NEED TO SHOW WORK
Write an inequality that best matches this description Mary has at least 3 times the amount of cash that ashley and oscar have combined
The dialogue editor first cleans the dialogue up, and then organizes it into the film's production sequence. True False
3. One of the many problems of the industrial sector is the weakening of the local industry due to industrialization. Which is the effect of this problem? A. Ma
pls answer soon it's a study guide ​