RamenDonkey
RamenDonkey RamenDonkey
  • 14-04-2021
  • Biology
contestada

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Respuesta :

addysenseheult addysenseheult
  • 14-04-2021

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

Answer Link

Otras preguntas

Diane has %1.75 in dimes and nickels. She has a total of 21 coins. How many of each does she have?
Which kind of complement is the underlined word? Please serve everybody appetizers before 6 o'clock.   A. indirect object
Diane has %1.75 in dimes and nickels. She has a total of 21 coins. How many of each does she have?
Why did the king end the stamp act
In the early 1500s, what method did Afonso de Albuquerque use to establish Portuguese outposts in India?
2.what triggered chinas 1899-1901 boxer rebellion? -a prolonged famine that had killed thousands of Chinese -the presence of westerners -the imprisonment of uni
What economic factors and conditions converged in the late 1920s to plunge the nation into the Great Depression?
60 is 40% of what number
What would 0.1666667 be as a fraction
What was The secret society that formed to overthrow the Hawaiian monarchy and establish democracy in Hawaii under American control known as?