Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3')?
The probe would need to bind to the site TTTTAGCCATTTACGATTAATCG
The sites that are bold are were the probe need to bind in order to target the DNA. The sequence of the prob needs a site that is complementary and antiparallel to it.
