dounyasaid46 dounyasaid46
  • 11-03-2022
  • Mathematics
contestada

1. what is the value of 8:3 = 24:x

Respuesta :

Аноним Аноним
  • 11-03-2022

Answer:

x = 9

Step-by-step explanation:

8 : 3 = 24 : x

=> 8/3 = 24/x

=> x = 24 x 3 / 8

=> x = 3 x 3

=> x = 9

Answer Link

Otras preguntas

it's all on the picture ​
Perdí mi tarea de español. Qué debo hacer?What do you do?​
Pls answer i will give brainliest pls
The area of the triangle below is 2/5 square foot. What is the length, in feet, of the base of the triangle? Choice A) 24/25 Choice B) 25/24 Choice C) 2/3 Choic
A 12-foot ladder is propped against a vertical wall. The top end is 11 ft above the ground. What is the measure of the angle formed by the ladder with the groun
I will mark Brainliest for frist answer
what is the mRNA in TACCGGATGCCAGATCAAATC?
. To buy a car, Mitchell borrowed $17,000 for 3 years at an annual simple interest rate of 9%. If it takes him 3 full years to pay off the loan, how much intere
Desertification can lead to starvation, malnutrition and poverty but the use of crop rotation and tree belts can help stop it True False
it's all on the picture ​