kyndallwallace23 kyndallwallace23

15-06-2022
Mathematics

contestada

what is the answer??? so confused

what is the answer so confused class=

Respuesta :

jsimpson11000 jsimpson11000

15-06-2022

Answer:

3 1/2

Step-by-step explanation:

Put '3' where 'y' is and compute :

[12 -3(3) ] / 2 + 3 [ (2(3)-4 )/3) =

3/2 + 2

= 3 1/2

Answer Link

Otras preguntas

if you like anime this is for ya

The growth of industrialism encouraged imperialism because it

Find the value of the expression. z + y2 for y = 6 and z = 1

Which graph shows a proportional relationship between x and y?

Replication, Transcription, and Translation Chart Please answer DNA Replication: 1。Template Strand: Start with this nucleotide chain. TACCCTTGAATAAAAAATCTCTGTTT

What are the chemicals for the two strands of nucleotides Answer fast pleaseee

the ability to use different parts of the body together smoothly and efficiently.

What's unique about the philosophical approach to the question of truth?

Plz help what does this mean in binary???? 01010100 01101000 01100101 00100000 01000110 01101001 01110100 01101110 01100101 01110011 01110011 01000111 01110010

HELP DOES ANYONE GET THIS? This is my “math help” class and I still don’t understand