slopez109 slopez109
  • 13-10-2017
  • Mathematics
contestada

a courier earns a fixed amount for each package she delivers, and yesterday her average hourly wage was $12.50 an hour. if she works 8 hours yesterday and delivered 25 packages, how much does she earn for each package deliver?

Respuesta :

jerryxx15
jerryxx15 jerryxx15
  • 18-10-2017
she makes 6.25$ for each package
Answer Link

Otras preguntas

Identify the structure of the human heart which is a large vein (right and left branches) that carries oxygenated blood from the lungs to the left atrium of the
jose jumped 8 1/3 feet. this mas 2 2/3 feet farther than Lila jumped. how far did Lila jump?
Solve for the letter w.
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg
Chelsea divided an apple into 8 equal pieces.she put the other 3 in the fridge. what fraction did Chelsea eat??
why will scientific models continue to improve
Sc.3, lines 85-90: cite the details that show how macbeth conceals his plot and furthers the motif of " false face."
I need help with this question
Find the perimeter of the triangle defined by the coordinates (9, 0), (-5, 0), and (-10, 6). (Round to nearest tenth)
Write a linear function for a line that passes through points (6,8) and (8,12)