kilimeaqua
kilimeaqua kilimeaqua
  • 14-12-2017
  • Mathematics
contestada

Simplify the expression below. 4^5x4^3

Respuesta :

aubriejohnson03 aubriejohnson03
  • 14-12-2017
I think it would be 16^8
because you needed to multiply the 4s and add the exponents
Answer Link

Otras preguntas

what are pheromones? 1. mating behaviors2. changes in appearance3 . chemical signals 4. patterns of behavior
Why does it take a long time to develop a new variety of tomato
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the
Which shows another way to write 11/2 A. 11 × 2 B. 11 + 2 C. 11 × 11
1. What is the value of w? 7 3.5 7(sqrt)of 3 14
Your apartment gets robbed, and $1,560 worth of your belongings are gone. You have renter's insurance to cover the loss, but your deductible is $500. How much w
The junior class has 50 students. Twenty-five students take only french, 15 take only Latin, and 10 take both. If a student is chosen at random from the class,
Can a rose window be considered an artistic expression?
How many different arrangements of 55 letters can be formed if the first letter must be w or k​ (repeats of letters are​ allowed)?
a line of iambic pentameter in a poem uses what symbol pattern