noneya
noneya
13-07-2014
Mathematics
contestada
The greatest common factor of 3m^2n+12mn^2 is
Respuesta :
Аноним
Аноним
13-07-2014
[tex]3m^2n=3mn\cdot m\\\\12mn^2=3mn\cdot4n\\\\GCF(3m^2n;\ 12mn^2)=3mn\\\\3m^2n+12mn^2=3mn(m+4n)[/tex]
Answer Link
VER TODAS LAS RESPUESTAS ( 14+ )
Otras preguntas
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the
In the excerpt from 20,000 leagues under the sea, how does the narrator show knowledge of ancient Greek culture
what is the traditional female gender role in the culture esquibel describe
WILL MARK BRAINLIEST! HURRY!! a student wants to study the effect of removing Thermal energy from a system. Which of the following experim
Marvin lives in Stormwind City and works as an engineer in the city of Ironforge. In the morning, he has 333 transportation options (teleport, ride a dragon, or
PLEASE HELP!!!Drag the tiles to the correct boxes to complete the pairs.Match the stages of the water cycle with the correct places in the model.
A tennis racket at sport city costs $180 and is discounted 15%. The same model racket costs $200 at tennis World and is on sale for 20% off. Which store is offe
Omg I hate reading but this ELA question is kicking my cousin ......... explain why the young fireflies complain about the Older fireflies. Use two details from
Depok deposited $256 in a savings account. The amount in the savings account increases by 1/2% every week. How much money was in the account after 4 weeks?
HELP PLEASE We found him under a cottonwood tree in the big arroyo near sheep camp. I guess he sat down to rest in the shade and never got up again." Leon walke
