hendricksmommyp40jrn hendricksmommyp40jrn

12-02-2018
Health

contestada

the phone in the veterinary hospital should be answered by the......... ring?

a. 5th ring
b. the veterinary assistant doesn't answer the phone
c. third ring
d. first ring

Respuesta :

12-02-2018

Letter c, the correct answer

Answer Link

Michele1099 Michele1099

13-02-2018

Answer by the third ring

Answer Link

Otras preguntas

25 POINTS : Which translation will change figure ABC to figure A'B'C'? 3 units right and 3 units up 4 units right and 3 units up 4 units right and 4 units

The aqua lung bringing ocean exploration to new depths what is the author's purpose in writing this passage

What is a business owned by a stockholder

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

A carnival game has 160 rubber ducks floating in a pool. The person playing the game takes out one duck and looks at it. If there’s a red mark on the bottom of

if the measure of ab is 8, find the length of circle c

1. What is the y intercept, and what dose it represent? (Must contain both questions for full credit) - 2. What is the slope, and what dose it represent? (Must

Which of these number is an integer? A. −4.0 B. 1.50 C. -5/8 D. infinity

what holy city are muslims expected to make a pilgrimage to at least once in their lives

How does a zip code relate to the rule of seven? a.a zip code has five numbers, and is most likely to be remembered. b.a zip code has no relevance to the rule