bellamollymae bellamollymae
  • 12-04-2018
  • Mathematics
contestada

Find the nth term of this quadratic sequence :
4,7,12,19,28

Respuesta :

CometZ CometZ
  • 12-04-2018
Answer is n^2+2

I attached a picture of my working out
Ver imagen CometZ
Answer Link
2004pandre
2004pandre 2004pandre
  • 11-05-2020

Answer:

n^2+3

Step-by-step explanation:

Answer Link

Otras preguntas

What influenced music in America the most during the 1960’s
As countries become industrialized and economically developed, the population growth rate ________ .
What were ALL the characteristics of the “new middle class” in the Renaissance?
please help me your my only hope giving 30 points and brainliest
Consider the graph the following exponential, y= 3(2)^x, Is the graph increasing or decreasing? What’s the y intercept? What’s the x intercept?
Who began to fight slavery after the Revolutionary War? A. All northern states B. Freed slaves C. Southern yeoman farmers D. All southern states
H= 3/4 (5a+b). solve for a
A study conducted at a certain college shows that 62% of the school's graduates find a job in their chosen field within a year after graduation. find the probab
A system of equations can be solved by elimination in table
Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds