franny4915 franny4915

13-05-2020
Mathematics

contestada

Find the area and perimeter of the triangle
a=8.8in b=5.9in c=10.59in

Respuesta :

asba0496 asba0496

13-05-2020

Answer:

25.29 - Perimeter

Step-by-step explanation:

8.8

5.9

+ 10.59

-----------------

25.29

For the area you will have to provide more information such as; which measurement is the base/hypotenuse, etc.

Answer Link

Otras preguntas

Write the ratio 3/9 4/9 in simplest form

A company pays it's workers 20$ a day .Is it a fixed cost or variable cost ??

Circle the letter of cach sentence that is true about silica. a. It is formed from oxygen and nitrogen. b. It makes magma thicker, . C. It is rarcly found in th

The Jones family want to enclose the garden with a fence. To the nearest foot (round to the nearest whole number), how much fencing will they need to buy?

Instead of allowing the clarification requests to age, how else might the HIM Manager attempt to resolve or escalate and keep the documentation flow progressing

Which numbers are perfect squares?

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Use this graph of y = -2x - 8x- 3 to find the vertex. Decide whether the vertex is a maximum or a minimum point. -5 A. Vertex is a minimum point at (-2,5) B. Ve

3 /1/6 + 4 5/6 help me pleaseeee

why is nobody talking about that video that got leaked? btw it's on my insta if u don't know what I'm talking about : di0r.miyah .