peterlegends12 peterlegends12
  • 11-09-2020
  • Mathematics
contestada

Can anyone help me with this?

Can anyone help me with this class=

Respuesta :

elijahdavis14 elijahdavis14
  • 11-09-2020

Answer:

a

Step-by-step explanation:

Answer Link
jadenmcelroy2025
jadenmcelroy2025 jadenmcelroy2025
  • 11-09-2020

Answer:

D

Step-by-step explanation:

Answer Link

Otras preguntas

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Solve the equations s + 10.5 - 19.
What is 1 benefit or positive thing about having political divisions?
What is the literary term for a very regular rhythm in a poem? * WILL GIVE BRANLEST* irony tone meter imagery
All of the following are examples of the Persian Empire except: A. Tolerance of conquered peoples B. Extensive road system C. Imperial bureaucracy D. Islam
Solve the one step equation: x-7=13
You mention natural disasters and how governments choose to respond o them. Do you think with increased attention to climate change that political socialization
What is the topic of this passage? A. The advantage and disadvantage of nuclear energy. B. The chernobyl disaster and its environmental impact. C. The problems
When we fail to recall information that we previously knew, we call that __________. Group of answer choices
How much power does a toaster have if it does 1,000 joules of work in 30 seconds?