mi3chaveligo mi3chaveligo

14-09-2016
Health

contestada

What should you do before putting dishes into the sink to be washed? Scrape leftover food from dishes into trash can Wash your hands Air dry dishes Sanitize dishes

Respuesta :

TabathaH TabathaH

21-09-2016

Scrape leftover food from the dishes into the trash can.

Answer Link

Otras preguntas

(5x+3)/49 = 9/(5x+3)

if you have 21 cats and give 2 away how much will you have

The Greek political reformer Cleisthenes _____ Select one: a. wrote epic poetry. b. established an Athenian constitution with many democratic features. c. preac

Although 8-year-old Claire can easily arrange sticks of differing lengths from shortest to tallest. She cannot solve the following problem: "Jack is taller than

The WRT Corporation makes collections on sales according to the following schedule: 25% in month of sale 65% in month following sale 5% in second month followi

Carefully examine the various political parties running candidates in the election of 1852. How do their various platforms point to what would ultimately become

How do the principles of management help a manager decide the managerial response towards an upcoming situations? in cbse class 12 business studies.

A restriction enzyme is coded for: AT!GC How long would the Base Pair fragments be for this DNA sequence? AGTCGAGTATATGCATGGCCGCGAT 1)25 and 0 2)25 and 25 3)14

40 POINTS!!! Two cars are 400 miles apart when they start moving towards each other. The speed of the first car is 30 mph. The second car moves 20 mph faster th

The following selected transactions relate to cash collections for a firm. Present entries to record the transactions for each of the two days of cash receipts