mooot2006
mooot2006
14-01-2021
Mathematics
contestada
5 x 5,503 estimate the product by rounding
Respuesta :
studentx38
studentx38
14-01-2021
My Answer to this would be: 25.26
Answer Link
VER TODAS LAS RESPUESTAS ( 79+ )
Otras preguntas
a skipping rope under constant vibration has a 5.0 cm amplitude and an 8.0 s period. What vertical position is the rope at when t = 5.0 s? b) Find two times whe
10. How did the author organize the information in the article? How does this organization help support the author's purpose in writing the article in what’s up
What state of liquid does point a represent in the Rankine cycle? Saturated liquid, subcooled liquid, superheated liquid, or Sat. liquid vapor mix?
5. What is the main doman and range of the roller coaster? (Hint: you should express these as a compound inequality or in interval notation
Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.
Which two words have a two letter difference?
5. What are the restrictions on the variable in the quotient x²+8x+16 +52-6? r²-2x-3 g2+52+6 Ox-6, x −1, x ‡ 1, x ‡ 3 Ox-6, x −3, x ‡ −1, x ‡ 1 Ox-3, x-1, x ‡ 1
Complète avec le bon mots : Pour fabriquer l'.............. nécessaire au bon fonctionnement des ................ (comme le muscle) , les animaux ont besoin de
ABC Inc has issued 10-year bonds that make semiannual coupon payments at a rate of 6 percent. The current market rate for similar securities is 7 percent. 1. Wh
A plumb bob does not hang exactly along a line directed to the center of the Earth, because of the Earth’s rotation. How much does the plumb bob deviate from a
