r8esaft9ygorgernawil r8esaft9ygorgernawil

14-11-2016
Mathematics

contestada

A salad costs $2. a steak dinner cost 6 times as much. how much does the steak dinner cost?
a. 6
b. 8
c. 10
d. 12

Respuesta :

Аноним Аноним

14-11-2016

d 12
multiply six times two answer is 12

Answer Link

Otras preguntas

I will give you all stars⭐⭐⭐⭐⭐

Explain how the relationship between the United States & the Soviet Union (USSR) fell apart.

Is the below sequence DNA or RNA? How do you know? GTTTACAGGCGGCGCAATATCTGATCG

You wish to have $200,000 at the end of twenty years. In the last five years, you withdraw $1,000 annually at a rate of 3.8% compounded quarterly. During the mi

What is the product of 40 and 7?

2 points 4.) The diagram to the right demonstrates a chicken and human embryo both within the same developmental time.Both embryos show slits homologous to fish

Explain the irony in the following quotation: Myrtle Wilson, describing the thrill of her first meeting with Tom Buchanan: "All I kept thinking about over and o

Please help. Question below.

henderson vs the US result

what is the repetition in the cats in krasinski square