marisolrodriguez9504 marisolrodriguez9504

13-05-2021
Health

contestada

What is another name for the "belly" region of the pig?

Respuesta :

13-05-2021

Answer:

Posterior refers to the tail end. Dorsal refers to the back side. The pig in figure 1 is lying on its dorsal side. Ventral is the belly side.

Answer Link

Otras preguntas

¿Cómo we llama la persona que lumpia la casa ? Niñera Dependiente Camarera Ama de llaves

Based on the graph below, what is the solution of the equation f(x) = g(x)? graph of function f of x equals negative x plus 0.5 and graph of function g of x equ

Showing too little emotinal response when reporting firgtening events is called

If a cell has four pairs of chromosomes, after mitosis each daughter cell will have how many chromosomes?

In 2003 the u.s. supreme court found that antisodomy laws were unconstitutional in the case of

jose bought 8 bags of oranges.each bag weighed 12 ounces. there are 16 ounces in a pound.how many pounds of oranges did jose buy

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se

Individuals representing the "new age" movement are more inclined to believe that

Hindu beliefs and practice have been preserved through an oral tradition and expressed in texts and hymns known as the:

Describe the difference between the lytic cycle and lysogeny when bacteriophage infection occurs.