sandersdeon320 sandersdeon320

14-10-2021
Biology

contestada

What is the oxidizing agent that accepts the electrons?

Respuesta :

ineedmathhelp1019 ineedmathhelp1019

14-10-2021

Answer:

oxygen, hydrogen peroxide and the halogens.

Explanation:

Answer Link

Otras preguntas

someone help tyyyyyy

(sqrt(2) + sqrt(3))/(3sqrt(2) - 2sqrt(3)) = a - b * sqrt(6) . Find a and b.

Three moles of helium gas have a volume of 15.0 L. When heated to 30.0 °C at constant pressure, it has a volume of 40.0 L. Determine its initial temperature.

Josie is a student in a fifth-grade inclusion class. She has a specific learning disability in mathematics and has difficulty solving word problems. As soon as

A dressmaker sells a shirt for $75 she makes a 25% profit how much did it cost her to make the shirt?

b) An aeroplane has 40 seats for passengers. Passengers travelling in economy class can take 20 kgs of baggage each and business class can take 60 kgs of baggag

Which of the following is NOT a characteristic of Terra Preta soil

I really need help step by step please

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

Discuss one issue that Southwest Deserts are facing due to Climate Change. To possibly earn full points, you need to include 3-5 thoughtful sentences on the iss