stephensca57 stephensca57
  • 15-04-2022
  • History
contestada

The media primarily influences the making of public policy by

Respuesta :

Jasonclxie
Jasonclxie Jasonclxie
  • 26-04-2022

Answer:

telling voters good or bad things about legislature.

Answer Link

Otras preguntas

Write the fraction as a mixed number. 31/6, 20/10, 15/8, 13/6
The Hubble space telescope is 569 km from Earth. If the gravitational force between Earth and the telescope is 1.37 × 107 N, and the mass of Earth is 5.98 × 102
The sum of two numbers is 48. If one third of one number is 5 greater than one sixth of another number, which of the following is the smaller number? A.6 B.26
what is the lcm of 24
Who can write a paragraph explaining what the world would be like without money?
A backpack weighs 8.2 newtons and has a mass of 5kg on the moon. What is the strength of the gravity on the moon?
which of the following is not a way that tobacco products are used
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
When the universe was 380,000 years old, its thermal radiation spectrum consisted mostly of?
Which sentence contains a correctly used participial phrase? A) Camping by the lakeside, the squawking geese kept me awake. B) After brushing on another strok